ID: 1202539608

View in Genome Browser
Species Human (GRCh38)
Location Y:25915496-25915518
Sequence AACTTTACTACAAAATACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202539608_1202539611 24 Left 1202539608 Y:25915496-25915518 CCTGGGTATTTTGTAGTAAAGTT No data
Right 1202539611 Y:25915543-25915565 AATTCTTTGAAGGAGCTGCAAGG No data
1202539608_1202539610 14 Left 1202539608 Y:25915496-25915518 CCTGGGTATTTTGTAGTAAAGTT No data
Right 1202539610 Y:25915533-25915555 ATATGTGACAAATTCTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202539608 Original CRISPR AACTTTACTACAAAATACCC AGG (reversed) Intergenic
No off target data available for this crispr