ID: 1202539609

View in Genome Browser
Species Human (GRCh38)
Location Y:25915524-25915546
Sequence AATTTGTCACATATGAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202539609_1202539612 3 Left 1202539609 Y:25915524-25915546 CCAAATTTCATATGTGACAAATT No data
Right 1202539612 Y:25915550-25915572 TGAAGGAGCTGCAAGGAAAGTGG No data
1202539609_1202539613 29 Left 1202539609 Y:25915524-25915546 CCAAATTTCATATGTGACAAATT No data
Right 1202539613 Y:25915576-25915598 ATTAAATGTGACCTCCAATGTGG No data
1202539609_1202539611 -4 Left 1202539609 Y:25915524-25915546 CCAAATTTCATATGTGACAAATT No data
Right 1202539611 Y:25915543-25915565 AATTCTTTGAAGGAGCTGCAAGG No data
1202539609_1202539614 30 Left 1202539609 Y:25915524-25915546 CCAAATTTCATATGTGACAAATT No data
Right 1202539614 Y:25915577-25915599 TTAAATGTGACCTCCAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202539609 Original CRISPR AATTTGTCACATATGAAATT TGG (reversed) Intergenic
No off target data available for this crispr