ID: 1202539611

View in Genome Browser
Species Human (GRCh38)
Location Y:25915543-25915565
Sequence AATTCTTTGAAGGAGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202539608_1202539611 24 Left 1202539608 Y:25915496-25915518 CCTGGGTATTTTGTAGTAAAGTT No data
Right 1202539611 Y:25915543-25915565 AATTCTTTGAAGGAGCTGCAAGG No data
1202539607_1202539611 30 Left 1202539607 Y:25915490-25915512 CCATGTCCTGGGTATTTTGTAGT No data
Right 1202539611 Y:25915543-25915565 AATTCTTTGAAGGAGCTGCAAGG No data
1202539609_1202539611 -4 Left 1202539609 Y:25915524-25915546 CCAAATTTCATATGTGACAAATT No data
Right 1202539611 Y:25915543-25915565 AATTCTTTGAAGGAGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202539611 Original CRISPR AATTCTTTGAAGGAGCTGCA AGG Intergenic
No off target data available for this crispr