ID: 1202539612

View in Genome Browser
Species Human (GRCh38)
Location Y:25915550-25915572
Sequence TGAAGGAGCTGCAAGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202539609_1202539612 3 Left 1202539609 Y:25915524-25915546 CCAAATTTCATATGTGACAAATT No data
Right 1202539612 Y:25915550-25915572 TGAAGGAGCTGCAAGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202539612 Original CRISPR TGAAGGAGCTGCAAGGAAAG TGG Intergenic
No off target data available for this crispr