ID: 1202539613

View in Genome Browser
Species Human (GRCh38)
Location Y:25915576-25915598
Sequence ATTAAATGTGACCTCCAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202539609_1202539613 29 Left 1202539609 Y:25915524-25915546 CCAAATTTCATATGTGACAAATT No data
Right 1202539613 Y:25915576-25915598 ATTAAATGTGACCTCCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202539613 Original CRISPR ATTAAATGTGACCTCCAATG TGG Intergenic
No off target data available for this crispr