ID: 1202539614

View in Genome Browser
Species Human (GRCh38)
Location Y:25915577-25915599
Sequence TTAAATGTGACCTCCAATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202539609_1202539614 30 Left 1202539609 Y:25915524-25915546 CCAAATTTCATATGTGACAAATT No data
Right 1202539614 Y:25915577-25915599 TTAAATGTGACCTCCAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202539614 Original CRISPR TTAAATGTGACCTCCAATGT GGG Intergenic
No off target data available for this crispr