ID: 1202541942

View in Genome Browser
Species Human (GRCh38)
Location Y:25947075-25947097
Sequence CAACCAACACTTAAGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202541942_1202541946 -6 Left 1202541942 Y:25947075-25947097 CCATTTTCCTTAAGTGTTGGTTG No data
Right 1202541946 Y:25947092-25947114 TGGTTGGTCTCAGAAATAAAGGG No data
1202541942_1202541947 27 Left 1202541942 Y:25947075-25947097 CCATTTTCCTTAAGTGTTGGTTG No data
Right 1202541947 Y:25947125-25947147 AAAGAGAGAAATTTTAAAGCTGG 0: 678
1: 418
2: 520
3: 312
4: 899
1202541942_1202541948 28 Left 1202541942 Y:25947075-25947097 CCATTTTCCTTAAGTGTTGGTTG No data
Right 1202541948 Y:25947126-25947148 AAGAGAGAAATTTTAAAGCTGGG 0: 639
1: 449
2: 525
3: 298
4: 754
1202541942_1202541945 -7 Left 1202541942 Y:25947075-25947097 CCATTTTCCTTAAGTGTTGGTTG No data
Right 1202541945 Y:25947091-25947113 TTGGTTGGTCTCAGAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202541942 Original CRISPR CAACCAACACTTAAGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr