ID: 1202544369

View in Genome Browser
Species Human (GRCh38)
Location Y:25974760-25974782
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 2, 1: 2, 2: 15, 3: 18, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202544365_1202544369 -9 Left 1202544365 Y:25974746-25974768 CCAGCCACATAAGACCCAGTGGG 0: 2
1: 2
2: 1
3: 17
4: 109
Right 1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG 0: 2
1: 2
2: 15
3: 18
4: 55
1202544358_1202544369 28 Left 1202544358 Y:25974709-25974731 CCAAGATTTGGAATGTCCCAGGT 0: 4
1: 0
2: 1
3: 11
4: 151
Right 1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG 0: 2
1: 2
2: 15
3: 18
4: 55
1202544363_1202544369 11 Left 1202544363 Y:25974726-25974748 CCAGGTTAGTGTTGGGGAAACCA 0: 6
1: 0
2: 0
3: 11
4: 137
Right 1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG 0: 2
1: 2
2: 15
3: 18
4: 55
1202544362_1202544369 12 Left 1202544362 Y:25974725-25974747 CCCAGGTTAGTGTTGGGGAAACC 0: 8
1: 0
2: 0
3: 11
4: 121
Right 1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG 0: 2
1: 2
2: 15
3: 18
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202544369 Original CRISPR CCCAGTGGGTACCCCGAATC TGG Intergenic
901192338 1:7420097-7420119 CCCAGTGGGGACCTCCACTCTGG + Intronic
902777934 1:18686443-18686465 CCTACTGCGTACCCCGAATCTGG + Intronic
906124092 1:43415975-43415997 CCCAGTAGGTCCCCTGAGTCTGG - Exonic
909257896 1:73448042-73448064 CCCAGTGGGGACCCTGTATGGGG + Intergenic
912930477 1:113954738-113954760 CACAGTGGGTACCCCAAATTAGG - Exonic
914460863 1:147883706-147883728 CCAAGTGGGTACCACTAACCAGG + Intergenic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
921065961 1:211621997-211622019 CCCAGTGGGGTCCCCGGGTCTGG + Intergenic
924775104 1:247111133-247111155 CCCGGCGGGTACCCCGAGTCCGG - Exonic
924792583 1:247266459-247266481 CCCAGTGGGCACCCCAATTCCGG - Intergenic
1064782368 10:18856671-18856693 CCCAGCAGGTACCCCGAGTCCGG + Intergenic
1085518499 11:77124823-77124845 CCCAGTGGGTGGCCTGACTCTGG - Exonic
1091963613 12:4720033-4720055 CCCAGCGGATACCCCGAGTCCGG + Intronic
1093370634 12:18360874-18360896 TCCAGTGGGTTTCCTGAATCTGG + Intronic
1095095366 12:38145008-38145030 GCCAGTGGGTACCCCGAGTCCGG - Intergenic
1097192773 12:57227265-57227287 CCCAGTGGGCACCCTGACCCCGG - Intergenic
1099492820 12:83307414-83307436 CCCAGTGGGTACTCTGTATGGGG - Intergenic
1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1111196260 13:84877275-84877297 CACAGTGGGTACCTTGAGTCTGG - Intergenic
1114999806 14:28408395-28408417 CCCAGTGGGACCCCAGAATGTGG - Intergenic
1116683794 14:48011733-48011755 CCCGGCGGGTACCCCGAGTCCGG - Intergenic
1120350002 14:83342876-83342898 CACAGTGGGTACGCCCAATCAGG + Intergenic
1122021863 14:98844666-98844688 CCCAGTGGGTACCACCCAGCAGG - Intergenic
1126825050 15:52540301-52540323 CCCAGTGGGGACCCAGAGTGGGG + Intergenic
1135075937 16:19393607-19393629 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1141518952 16:84564776-84564798 CCCTGTGGGAGCCCAGAATCAGG - Intergenic
1144958087 17:19029688-19029710 CCCAGAGGGTAGCCCCAGTCTGG - Intronic
1144977071 17:19144832-19144854 CCCAGAGGGTAGCCCCAGTCTGG + Intronic
1146939749 17:36836321-36836343 CCCAGTGTGTCCCTAGAATCTGG - Intergenic
1148552535 17:48559148-48559170 CCCACTGGGTACCCAGTATCAGG + Intronic
1153388469 18:4527644-4527666 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1158856118 18:61544556-61544578 GCCACTGGGAAGCCCGAATCCGG - Intronic
1160535107 18:79587400-79587422 CCCAGTGGGCACCCCGTAGATGG + Intergenic
1162079169 19:8208734-8208756 CACCCTGGGTACCCCGAGTCTGG - Intronic
1164767829 19:30785165-30785187 GCCAGAGGGGACCCCGAATGAGG - Intergenic
1165895625 19:39139354-39139376 CCCGCTGGGTACCCCGACACTGG - Intronic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933239469 2:79903760-79903782 GCCAGTGGGGAGCCCGGATCAGG + Intronic
933362355 2:81304456-81304478 CCCAGCTGGTACCCCAAGTCCGG + Intergenic
933418910 2:82023196-82023218 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933419855 2:82031232-82031254 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
937715155 2:125024234-125024256 CCCAGTGGGTACCCTGAGTCCGG + Intergenic
942830989 2:180237390-180237412 CCCAGCGGGTACCCGGAGTCTGG - Intergenic
943833208 2:192487900-192487922 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
943960439 2:194256185-194256207 CCCGGCCGGTACCCCGAGTCCGG + Intergenic
1169083029 20:2809078-2809100 CCTAGCGGTTACCCCGAGTCCGG + Intergenic
1175258834 20:57662662-57662684 CCCTGTGTGTACCCTGAATGCGG - Intronic
1183604359 22:38860047-38860069 CCCAGTGGCAGCCCCGTATCCGG + Intergenic
1184220893 22:43099170-43099192 CCCAGTGGGAACCTGGAACCTGG - Intergenic
950662209 3:14473507-14473529 CCAAGTGGGTCCCCAGAACCTGG + Intronic
951994035 3:28706901-28706923 ACCAGTGGATTCCCCAAATCTGG - Intergenic
951999786 3:28772315-28772337 CCCACTGGGTACTCCTAGTCAGG - Intergenic
952107102 3:30083569-30083591 TTCAGTGGCCACCCCGAATCAGG - Intergenic
957694551 3:83618435-83618457 CCCAGCGGGTACTCCGAGTCCGG + Intergenic
957738634 3:84233868-84233890 CCCAGTGGGAACCCCGTGTGGGG + Intergenic
962813748 3:138980278-138980300 CCCTGTGTGCACTCCGAATCCGG - Intergenic
963498990 3:146101061-146101083 CCCAGTGGTTAACCAGAACCTGG - Intronic
965397245 3:168174363-168174385 CCCAGTGGGGACCCTGTATGAGG + Intergenic
967749882 3:193101591-193101613 CCCAGTGGGTGCTCTGAATGGGG - Intergenic
976214329 4:82701573-82701595 TCCAGTGGGTGGCCTGAATCAGG + Intronic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
977789691 4:101084923-101084945 CCCATCTGGTACCCAGAATCAGG + Intronic
979126607 4:116980760-116980782 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
983327431 4:166274578-166274600 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
988842396 5:35095769-35095791 CCCAATGGGTACCTCAAAACAGG - Intronic
1008236485 6:49057686-49057708 CCCAGTGGGTACCCAGTGTGGGG + Intergenic
1013338696 6:109191883-109191905 CCCAGTGGGGACCCCATATAGGG - Intergenic
1020002237 7:4762496-4762518 CCCAGCGGCGACCCCGAAGCTGG + Exonic
1020939216 7:14509780-14509802 CCCAGCAGGTACCCCGAGTCTGG - Intronic
1024137330 7:46423638-46423660 CCCAGTGGGTTCCCCACCTCTGG + Intergenic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1033669104 7:143472697-143472719 CCCAGCGGGTACTCCGAGTCCGG - Intergenic
1040138433 8:43882515-43882537 CCCCGTGGGTGCCCCTAGTCTGG + Intergenic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1043295335 8:78654629-78654651 CCCAGTGTGTACCCCAAGTCCGG - Intergenic
1045993689 8:108339110-108339132 CCCAGTGGGGACTCTGTATCGGG + Intronic
1057557768 9:96101231-96101253 CCCAGTGGATACCCTGCTTCAGG + Intergenic
1058712084 9:107688344-107688366 CCCAGCGGGTACCACGTACCAGG - Intergenic
1062615044 9:137392524-137392546 CCCAGTGGGCTCCCCTACTCAGG - Intronic
1193318604 X:80094179-80094201 CCAAGGGGCTACCCAGAATCTGG - Intergenic
1194132282 X:90095942-90095964 CCCAGTGGGGACTCTGTATCAGG - Intergenic
1199011837 X:142767892-142767914 CCCAACAGGTACCCCGCATCTGG + Intergenic
1200478081 Y:3666030-3666052 CCCAGTGGGGACTCTGTATCAGG - Intergenic
1200971264 Y:9155008-9155030 TCCAGTGTATACCCCCAATCAGG - Intergenic
1201776467 Y:17671239-17671261 CCCAGTGGGTACACTGACTCTGG + Intergenic
1201783215 Y:17745357-17745379 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
1201818338 Y:18160630-18160652 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1201825089 Y:18234753-18234775 CCCAGTGGGTACACTGACTCTGG - Intergenic
1202174576 Y:22085606-22085628 CCCAGTGGGTACCCCGAATCTGG - Intronic
1202216784 Y:22500776-22500798 CCCAGTGTGTACCCCGAATCTGG + Intronic
1202326403 Y:23695294-23695316 CCCAGTGTGTACCCCGAATCTGG - Intergenic
1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG + Intergenic