ID: 1202544813

View in Genome Browser
Species Human (GRCh38)
Location Y:25978478-25978500
Sequence TTTGTAGGCCCCTGGTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202544813_1202544820 0 Left 1202544813 Y:25978478-25978500 CCTTCAAACCAGGGGCCTACAAA No data
Right 1202544820 Y:25978501-25978523 TGGGAAGGATGATTTCCTCTGGG No data
1202544813_1202544819 -1 Left 1202544813 Y:25978478-25978500 CCTTCAAACCAGGGGCCTACAAA No data
Right 1202544819 Y:25978500-25978522 ATGGGAAGGATGATTTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202544813 Original CRISPR TTTGTAGGCCCCTGGTTTGA AGG (reversed) Intergenic
No off target data available for this crispr