ID: 1202546833

View in Genome Browser
Species Human (GRCh38)
Location Y:25999522-25999544
Sequence CACCTAGAATTATCTAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202546833_1202546834 10 Left 1202546833 Y:25999522-25999544 CCAGGGCTAGATAATTCTAGGTG No data
Right 1202546834 Y:25999555-25999577 TGAATACTCAAGCATCTTCTAGG No data
1202546833_1202546836 12 Left 1202546833 Y:25999522-25999544 CCAGGGCTAGATAATTCTAGGTG No data
Right 1202546836 Y:25999557-25999579 AATACTCAAGCATCTTCTAGGGG No data
1202546833_1202546837 15 Left 1202546833 Y:25999522-25999544 CCAGGGCTAGATAATTCTAGGTG No data
Right 1202546837 Y:25999560-25999582 ACTCAAGCATCTTCTAGGGGAGG No data
1202546833_1202546835 11 Left 1202546833 Y:25999522-25999544 CCAGGGCTAGATAATTCTAGGTG No data
Right 1202546835 Y:25999556-25999578 GAATACTCAAGCATCTTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202546833 Original CRISPR CACCTAGAATTATCTAGCCC TGG (reversed) Intergenic
No off target data available for this crispr