ID: 1202548756

View in Genome Browser
Species Human (GRCh38)
Location Y:26024742-26024764
Sequence TCTGAAAGGCAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202548756_1202548763 30 Left 1202548756 Y:26024742-26024764 CCTTCCTCTTTCTGCCTTTCAGA No data
Right 1202548763 Y:26024795-26024817 ATGGTGTTTTAGTTGTTTAGAGG No data
1202548756_1202548761 11 Left 1202548756 Y:26024742-26024764 CCTTCCTCTTTCTGCCTTTCAGA No data
Right 1202548761 Y:26024776-26024798 TTTTTTTCTCGTTATATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202548756 Original CRISPR TCTGAAAGGCAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr