ID: 1202550236

View in Genome Browser
Species Human (GRCh38)
Location Y:26041631-26041653
Sequence TGACCCATGAATTTTAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202550234_1202550236 8 Left 1202550234 Y:26041600-26041622 CCTTGGTTTGGTGTAGCAGGTTT No data
Right 1202550236 Y:26041631-26041653 TGACCCATGAATTTTAAAAGAGG No data
1202550229_1202550236 26 Left 1202550229 Y:26041582-26041604 CCCAATGGGAGGATGAGACCTTG No data
Right 1202550236 Y:26041631-26041653 TGACCCATGAATTTTAAAAGAGG No data
1202550230_1202550236 25 Left 1202550230 Y:26041583-26041605 CCAATGGGAGGATGAGACCTTGG No data
Right 1202550236 Y:26041631-26041653 TGACCCATGAATTTTAAAAGAGG No data
1202550228_1202550236 27 Left 1202550228 Y:26041581-26041603 CCCCAATGGGAGGATGAGACCTT No data
Right 1202550236 Y:26041631-26041653 TGACCCATGAATTTTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202550236 Original CRISPR TGACCCATGAATTTTAAAAG AGG Intergenic
No off target data available for this crispr