ID: 1202555454

View in Genome Browser
Species Human (GRCh38)
Location Y:26099242-26099264
Sequence CTGAGCTGCAGTTGTGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202555453_1202555454 3 Left 1202555453 Y:26099216-26099238 CCACAAAATGACAGCAGCATGCT No data
Right 1202555454 Y:26099242-26099264 CTGAGCTGCAGTTGTGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202555454 Original CRISPR CTGAGCTGCAGTTGTGCATA TGG Intergenic
No off target data available for this crispr