ID: 1202558403

View in Genome Browser
Species Human (GRCh38)
Location Y:26129561-26129583
Sequence GGGAATTATCTAGCAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202558403_1202558409 21 Left 1202558403 Y:26129561-26129583 CCTGTGTTTGCTAGATAATTCCC No data
Right 1202558409 Y:26129605-26129627 TAGCAGTATTCTTTGATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202558403 Original CRISPR GGGAATTATCTAGCAAACAC AGG (reversed) Intergenic
No off target data available for this crispr