ID: 1202559089

View in Genome Browser
Species Human (GRCh38)
Location Y:26137688-26137710
Sequence GCTTCCATGGAGAAGCTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202559089_1202559093 5 Left 1202559089 Y:26137688-26137710 CCTTTCAGCTTCTCCATGGAAGC No data
Right 1202559093 Y:26137716-26137738 ACCTTTTAAACTCCTCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202559089 Original CRISPR GCTTCCATGGAGAAGCTGAA AGG (reversed) Intergenic
No off target data available for this crispr