ID: 1202567555

View in Genome Browser
Species Human (GRCh38)
Location Y:26230016-26230038
Sequence CCAGTCCTACAAACTAATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202567555_1202567558 27 Left 1202567555 Y:26230016-26230038 CCCTAATTAGTTTGTAGGACTGG No data
Right 1202567558 Y:26230066-26230088 GTTCCCTTTATGCACATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202567555 Original CRISPR CCAGTCCTACAAACTAATTA GGG (reversed) Intergenic