ID: 1202567557

View in Genome Browser
Species Human (GRCh38)
Location Y:26230017-26230039
Sequence ACCAGTCCTACAAACTAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202567557_1202567558 26 Left 1202567557 Y:26230017-26230039 CCTAATTAGTTTGTAGGACTGGT No data
Right 1202567558 Y:26230066-26230088 GTTCCCTTTATGCACATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202567557 Original CRISPR ACCAGTCCTACAAACTAATT AGG (reversed) Intergenic