ID: 1202567558

View in Genome Browser
Species Human (GRCh38)
Location Y:26230066-26230088
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202567555_1202567558 27 Left 1202567555 Y:26230016-26230038 CCCTAATTAGTTTGTAGGACTGG No data
Right 1202567558 Y:26230066-26230088 GTTCCCTTTATGCACATTAATGG No data
1202567557_1202567558 26 Left 1202567557 Y:26230017-26230039 CCTAATTAGTTTGTAGGACTGGT No data
Right 1202567558 Y:26230066-26230088 GTTCCCTTTATGCACATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202567558 Original CRISPR GTTCCCTTTATGCACATTAA TGG Intergenic