ID: 1202567847

View in Genome Browser
Species Human (GRCh38)
Location Y:26233356-26233378
Sequence TGTGGCTCCTTGGGAAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202567838_1202567847 15 Left 1202567838 Y:26233318-26233340 CCAAAAAATACCCAACAGCTAGT No data
Right 1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG No data
1202567842_1202567847 5 Left 1202567842 Y:26233328-26233350 CCCAACAGCTAGTGGGGTGAAAG No data
Right 1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG No data
1202567837_1202567847 18 Left 1202567837 Y:26233315-26233337 CCACCAAAAAATACCCAACAGCT No data
Right 1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG No data
1202567843_1202567847 4 Left 1202567843 Y:26233329-26233351 CCAACAGCTAGTGGGGTGAAAGC No data
Right 1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202567847 Original CRISPR TGTGGCTCCTTGGGAAAAAG AGG Intergenic
No off target data available for this crispr