ID: 1202570540

View in Genome Browser
Species Human (GRCh38)
Location Y:26264398-26264420
Sequence TTCTGGATACGGAGGTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202570540_1202570546 -8 Left 1202570540 Y:26264398-26264420 CCATGTCACCTCCGTATCCAGAA No data
Right 1202570546 Y:26264413-26264435 ATCCAGAATCTCAAGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202570540 Original CRISPR TTCTGGATACGGAGGTGACA TGG (reversed) Intergenic
No off target data available for this crispr