ID: 1202579446

View in Genome Browser
Species Human (GRCh38)
Location Y:26363968-26363990
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202579446_1202579450 17 Left 1202579446 Y:26363968-26363990 CCATTCCCCATGCTTTTATTCAC No data
Right 1202579450 Y:26364008-26364030 CACTCAGCTGTCTTACAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202579446 Original CRISPR GTGAATAAAAGCATGGGGAA TGG (reversed) Intergenic
No off target data available for this crispr