ID: 1202579722

View in Genome Browser
Species Human (GRCh38)
Location Y:26367059-26367081
Sequence GTTCTCACTATTCCAAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202579718_1202579722 4 Left 1202579718 Y:26367032-26367054 CCCCTTTTTAGTCTATCCATGCA No data
Right 1202579722 Y:26367059-26367081 GTTCTCACTATTCCAAAAAATGG No data
1202579714_1202579722 11 Left 1202579714 Y:26367025-26367047 CCCCTACCCCCTTTTTAGTCTAT No data
Right 1202579722 Y:26367059-26367081 GTTCTCACTATTCCAAAAAATGG No data
1202579715_1202579722 10 Left 1202579715 Y:26367026-26367048 CCCTACCCCCTTTTTAGTCTATC No data
Right 1202579722 Y:26367059-26367081 GTTCTCACTATTCCAAAAAATGG No data
1202579716_1202579722 9 Left 1202579716 Y:26367027-26367049 CCTACCCCCTTTTTAGTCTATCC No data
Right 1202579722 Y:26367059-26367081 GTTCTCACTATTCCAAAAAATGG No data
1202579719_1202579722 3 Left 1202579719 Y:26367033-26367055 CCCTTTTTAGTCTATCCATGCAT No data
Right 1202579722 Y:26367059-26367081 GTTCTCACTATTCCAAAAAATGG No data
1202579720_1202579722 2 Left 1202579720 Y:26367034-26367056 CCTTTTTAGTCTATCCATGCATA No data
Right 1202579722 Y:26367059-26367081 GTTCTCACTATTCCAAAAAATGG No data
1202579717_1202579722 5 Left 1202579717 Y:26367031-26367053 CCCCCTTTTTAGTCTATCCATGC No data
Right 1202579722 Y:26367059-26367081 GTTCTCACTATTCCAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202579722 Original CRISPR GTTCTCACTATTCCAAAAAA TGG Intergenic
No off target data available for this crispr