ID: 1202589791

View in Genome Browser
Species Human (GRCh38)
Location Y:26470621-26470643
Sequence TGTCCTCTTCTAAGCTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202589791_1202589793 -7 Left 1202589791 Y:26470621-26470643 CCACCTGAGCTTAGAAGAGGACA No data
Right 1202589793 Y:26470637-26470659 GAGGACACTAAGTTTTAAAAAGG No data
1202589791_1202589794 5 Left 1202589791 Y:26470621-26470643 CCACCTGAGCTTAGAAGAGGACA No data
Right 1202589794 Y:26470649-26470671 TTTTAAAAAGGACCACAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202589791 Original CRISPR TGTCCTCTTCTAAGCTCAGG TGG (reversed) Intergenic
No off target data available for this crispr