ID: 1202589794

View in Genome Browser
Species Human (GRCh38)
Location Y:26470649-26470671
Sequence TTTTAAAAAGGACCACAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202589788_1202589794 16 Left 1202589788 Y:26470610-26470632 CCTGCCAACAACCACCTGAGCTT No data
Right 1202589794 Y:26470649-26470671 TTTTAAAAAGGACCACAGTCTGG No data
1202589791_1202589794 5 Left 1202589791 Y:26470621-26470643 CCACCTGAGCTTAGAAGAGGACA No data
Right 1202589794 Y:26470649-26470671 TTTTAAAAAGGACCACAGTCTGG No data
1202589792_1202589794 2 Left 1202589792 Y:26470624-26470646 CCTGAGCTTAGAAGAGGACACTA No data
Right 1202589794 Y:26470649-26470671 TTTTAAAAAGGACCACAGTCTGG No data
1202589789_1202589794 12 Left 1202589789 Y:26470614-26470636 CCAACAACCACCTGAGCTTAGAA No data
Right 1202589794 Y:26470649-26470671 TTTTAAAAAGGACCACAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202589794 Original CRISPR TTTTAAAAAGGACCACAGTC TGG Intergenic
No off target data available for this crispr