ID: 1202598558

View in Genome Browser
Species Human (GRCh38)
Location Y:26569190-26569212
Sequence ACTGGCGGGAGCCACCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202598545_1202598558 26 Left 1202598545 Y:26569141-26569163 CCTGATGCCATGTGATCTGCCCA No data
Right 1202598558 Y:26569190-26569212 ACTGGCGGGAGCCACCATGATGG No data
1202598555_1202598558 -7 Left 1202598555 Y:26569174-26569196 CCGAAGTGCTGGGATTACTGGCG 0: 520
1: 124355
2: 271849
3: 224957
4: 154049
Right 1202598558 Y:26569190-26569212 ACTGGCGGGAGCCACCATGATGG No data
1202598549_1202598558 6 Left 1202598549 Y:26569161-26569183 CCACTTCGGCCTCCCGAAGTGCT 0: 79
1: 4535
2: 102542
3: 193407
4: 134707
Right 1202598558 Y:26569190-26569212 ACTGGCGGGAGCCACCATGATGG No data
1202598554_1202598558 -6 Left 1202598554 Y:26569173-26569195 CCCGAAGTGCTGGGATTACTGGC 0: 26
1: 5990
2: 229284
3: 279952
4: 271030
Right 1202598558 Y:26569190-26569212 ACTGGCGGGAGCCACCATGATGG No data
1202598547_1202598558 19 Left 1202598547 Y:26569148-26569170 CCATGTGATCTGCCCACTTCGGC 0: 36
1: 1365
2: 8377
3: 25918
4: 53581
Right 1202598558 Y:26569190-26569212 ACTGGCGGGAGCCACCATGATGG No data
1202598552_1202598558 -3 Left 1202598552 Y:26569170-26569192 CCTCCCGAAGTGCTGGGATTACT 0: 34
1: 7023
2: 304642
3: 272443
4: 208971
Right 1202598558 Y:26569190-26569212 ACTGGCGGGAGCCACCATGATGG No data
1202598548_1202598558 7 Left 1202598548 Y:26569160-26569182 CCCACTTCGGCCTCCCGAAGTGC 0: 44
1: 2280
2: 48873
3: 203346
4: 276267
Right 1202598558 Y:26569190-26569212 ACTGGCGGGAGCCACCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202598558 Original CRISPR ACTGGCGGGAGCCACCATGA TGG Intergenic
No off target data available for this crispr