ID: 1202599711

View in Genome Browser
Species Human (GRCh38)
Location Y:26580875-26580897
Sequence GTATTAAGGCATGAGCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202599707_1202599711 -8 Left 1202599707 Y:26580860-26580882 CCTCCCAAAGTGCTGGTATTAAG No data
Right 1202599711 Y:26580875-26580897 GTATTAAGGCATGAGCCACCAGG No data
1202599706_1202599711 -2 Left 1202599706 Y:26580854-26580876 CCTCAGCCTCCCAAAGTGCTGGT 0: 918
1: 91465
2: 214452
3: 239863
4: 266267
Right 1202599711 Y:26580875-26580897 GTATTAAGGCATGAGCCACCAGG No data
1202599703_1202599711 21 Left 1202599703 Y:26580831-26580853 CCTGAACTCAAGCAATCTGCCTG 0: 29
1: 718
2: 3770
3: 17789
4: 53897
Right 1202599711 Y:26580875-26580897 GTATTAAGGCATGAGCCACCAGG No data
1202599704_1202599711 2 Left 1202599704 Y:26580850-26580872 CCTGCCTCAGCCTCCCAAAGTGC 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
Right 1202599711 Y:26580875-26580897 GTATTAAGGCATGAGCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202599711 Original CRISPR GTATTAAGGCATGAGCCACC AGG Intergenic
No off target data available for this crispr