ID: 1202600060 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:26584598-26584620 |
| Sequence | TTGAAACTATTCCAAAGAAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1202600060_1202600061 | 8 | Left | 1202600060 | Y:26584598-26584620 | CCTGTTCTTTGGAATAGTTTCAA | No data | ||
| Right | 1202600061 | Y:26584629-26584651 | GTACCAGTTCTTTGTACATCTGG | 0: 19 1: 31 2: 64 3: 117 4: 318 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1202600060 | Original CRISPR | TTGAAACTATTCCAAAGAAC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||