ID: 1202600060

View in Genome Browser
Species Human (GRCh38)
Location Y:26584598-26584620
Sequence TTGAAACTATTCCAAAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202600060_1202600061 8 Left 1202600060 Y:26584598-26584620 CCTGTTCTTTGGAATAGTTTCAA No data
Right 1202600061 Y:26584629-26584651 GTACCAGTTCTTTGTACATCTGG 0: 19
1: 31
2: 64
3: 117
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202600060 Original CRISPR TTGAAACTATTCCAAAGAAC AGG (reversed) Intergenic
No off target data available for this crispr