ID: 1202624458

View in Genome Browser
Species Human (GRCh38)
Location Y:56843126-56843148
Sequence CTGGTGATGTAACATTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202624454_1202624458 17 Left 1202624454 Y:56843086-56843108 CCTACTGGGGACATTGTGACATA No data
Right 1202624458 Y:56843126-56843148 CTGGTGATGTAACATTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202624458 Original CRISPR CTGGTGATGTAACATTTGTC TGG Intergenic
No off target data available for this crispr