ID: 1202636503

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270706v1_random:48683-48705
Sequence TGTACAGGACCTCCCAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202636503_1202636510 -1 Left 1202636503 1_KI270706v1_random:48683-48705 CCCCATTTGGGAGGTCCTGTACA No data
Right 1202636510 1_KI270706v1_random:48705-48727 AGTGATGTGCAACAAGGTCGGGG No data
1202636503_1202636508 -3 Left 1202636503 1_KI270706v1_random:48683-48705 CCCCATTTGGGAGGTCCTGTACA No data
Right 1202636508 1_KI270706v1_random:48703-48725 ACAGTGATGTGCAACAAGGTCGG No data
1202636503_1202636511 0 Left 1202636503 1_KI270706v1_random:48683-48705 CCCCATTTGGGAGGTCCTGTACA No data
Right 1202636511 1_KI270706v1_random:48706-48728 GTGATGTGCAACAAGGTCGGGGG No data
1202636503_1202636509 -2 Left 1202636503 1_KI270706v1_random:48683-48705 CCCCATTTGGGAGGTCCTGTACA No data
Right 1202636509 1_KI270706v1_random:48704-48726 CAGTGATGTGCAACAAGGTCGGG No data
1202636503_1202636507 -7 Left 1202636503 1_KI270706v1_random:48683-48705 CCCCATTTGGGAGGTCCTGTACA No data
Right 1202636507 1_KI270706v1_random:48699-48721 CTGTACAGTGATGTGCAACAAGG No data
1202636503_1202636512 22 Left 1202636503 1_KI270706v1_random:48683-48705 CCCCATTTGGGAGGTCCTGTACA No data
Right 1202636512 1_KI270706v1_random:48728-48750 GCCTGCTTACAGAAGCATTCTGG 0: 11
1: 14
2: 7
3: 121
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202636503 Original CRISPR TGTACAGGACCTCCCAAATG GGG (reversed) Intergenic
No off target data available for this crispr