ID: 1202647080

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270706v1_random:152726-152748
Sequence CGCGATCCAGAGGCCGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202647080_1202647090 16 Left 1202647080 1_KI270706v1_random:152726-152748 CCCTGGGCGGCCTCTGGATCGCG No data
Right 1202647090 1_KI270706v1_random:152765-152787 GAGCCTGCCAGACCCTGCCCCGG No data
1202647080_1202647092 21 Left 1202647080 1_KI270706v1_random:152726-152748 CCCTGGGCGGCCTCTGGATCGCG No data
Right 1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202647080 Original CRISPR CGCGATCCAGAGGCCGCCCA GGG (reversed) Intergenic
No off target data available for this crispr