ID: 1202647081

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270706v1_random:152727-152749
Sequence CCGCGATCCAGAGGCCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202647081_1202647092 20 Left 1202647081 1_KI270706v1_random:152727-152749 CCTGGGCGGCCTCTGGATCGCGG No data
Right 1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG No data
1202647081_1202647090 15 Left 1202647081 1_KI270706v1_random:152727-152749 CCTGGGCGGCCTCTGGATCGCGG No data
Right 1202647090 1_KI270706v1_random:152765-152787 GAGCCTGCCAGACCCTGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202647081 Original CRISPR CCGCGATCCAGAGGCCGCCC AGG (reversed) Intergenic
No off target data available for this crispr