ID: 1202647084

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270706v1_random:152736-152758
Sequence CAGGGGCACCCGCGATCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202647084_1202647092 11 Left 1202647084 1_KI270706v1_random:152736-152758 CCTCTGGATCGCGGGTGCCCCTG No data
Right 1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG No data
1202647084_1202647090 6 Left 1202647084 1_KI270706v1_random:152736-152758 CCTCTGGATCGCGGGTGCCCCTG No data
Right 1202647090 1_KI270706v1_random:152765-152787 GAGCCTGCCAGACCCTGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202647084 Original CRISPR CAGGGGCACCCGCGATCCAG AGG (reversed) Intergenic
No off target data available for this crispr