ID: 1202647086

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270706v1_random:152753-152775
Sequence CTGGCAGGCTCTCAGGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202647086_1202647105 30 Left 1202647086 1_KI270706v1_random:152753-152775 CCCCTGGCCTGAGAGCCTGCCAG No data
Right 1202647105 1_KI270706v1_random:152806-152828 AGAGCTCCAGATCTCTATCCAGG No data
1202647086_1202647092 -6 Left 1202647086 1_KI270706v1_random:152753-152775 CCCCTGGCCTGAGAGCCTGCCAG No data
Right 1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202647086 Original CRISPR CTGGCAGGCTCTCAGGCCAG GGG (reversed) Intergenic
No off target data available for this crispr