ID: 1202647088

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270706v1_random:152755-152777
Sequence GTCTGGCAGGCTCTCAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202647088_1202647105 28 Left 1202647088 1_KI270706v1_random:152755-152777 CCTGGCCTGAGAGCCTGCCAGAC No data
Right 1202647105 1_KI270706v1_random:152806-152828 AGAGCTCCAGATCTCTATCCAGG No data
1202647088_1202647107 30 Left 1202647088 1_KI270706v1_random:152755-152777 CCTGGCCTGAGAGCCTGCCAGAC No data
Right 1202647107 1_KI270706v1_random:152808-152830 AGCTCCAGATCTCTATCCAGGGG No data
1202647088_1202647092 -8 Left 1202647088 1_KI270706v1_random:152755-152777 CCTGGCCTGAGAGCCTGCCAGAC No data
Right 1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG No data
1202647088_1202647106 29 Left 1202647088 1_KI270706v1_random:152755-152777 CCTGGCCTGAGAGCCTGCCAGAC No data
Right 1202647106 1_KI270706v1_random:152807-152829 GAGCTCCAGATCTCTATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202647088 Original CRISPR GTCTGGCAGGCTCTCAGGCC AGG (reversed) Intergenic
No off target data available for this crispr