ID: 1202647092

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270706v1_random:152770-152792
Sequence TGCCAGACCCTGCCCCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202647081_1202647092 20 Left 1202647081 1_KI270706v1_random:152727-152749 CCTGGGCGGCCTCTGGATCGCGG No data
Right 1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG No data
1202647086_1202647092 -6 Left 1202647086 1_KI270706v1_random:152753-152775 CCCCTGGCCTGAGAGCCTGCCAG No data
Right 1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG No data
1202647084_1202647092 11 Left 1202647084 1_KI270706v1_random:152736-152758 CCTCTGGATCGCGGGTGCCCCTG No data
Right 1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG No data
1202647088_1202647092 -8 Left 1202647088 1_KI270706v1_random:152755-152777 CCTGGCCTGAGAGCCTGCCAGAC No data
Right 1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG No data
1202647087_1202647092 -7 Left 1202647087 1_KI270706v1_random:152754-152776 CCCTGGCCTGAGAGCCTGCCAGA No data
Right 1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG No data
1202647080_1202647092 21 Left 1202647080 1_KI270706v1_random:152726-152748 CCCTGGGCGGCCTCTGGATCGCG No data
Right 1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202647092 Original CRISPR TGCCAGACCCTGCCCCGGCC CGG Intergenic
No off target data available for this crispr