ID: 1202648540

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270706v1_random:161179-161201
Sequence GTGTGACAGTAGCAAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202648538_1202648540 7 Left 1202648538 1_KI270706v1_random:161149-161171 CCATTACAGGGGACTCTTCTGCT No data
Right 1202648540 1_KI270706v1_random:161179-161201 GTGTGACAGTAGCAAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202648540 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG Intergenic
No off target data available for this crispr