ID: 1202648894

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270706v1_random:163157-163179
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202648878_1202648894 22 Left 1202648878 1_KI270706v1_random:163112-163134 CCTGGTGAGGAGCTGCCCCTTGG No data
Right 1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG No data
1202648885_1202648894 5 Left 1202648885 1_KI270706v1_random:163129-163151 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG No data
1202648884_1202648894 6 Left 1202648884 1_KI270706v1_random:163128-163150 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG No data
1202648877_1202648894 23 Left 1202648877 1_KI270706v1_random:163111-163133 CCCTGGTGAGGAGCTGCCCCTTG No data
Right 1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG No data
1202648882_1202648894 7 Left 1202648882 1_KI270706v1_random:163127-163149 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG No data
1202648876_1202648894 29 Left 1202648876 1_KI270706v1_random:163105-163127 CCACATCCCTGGTGAGGAGCTGC No data
Right 1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202648894 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr