ID: 1202649233

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270706v1_random:165802-165824
Sequence CTTATGAACGGTCCCCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202649230_1202649233 8 Left 1202649230 1_KI270706v1_random:165771-165793 CCTAAGAACAGTAGGGTCTTGTC No data
Right 1202649233 1_KI270706v1_random:165802-165824 CTTATGAACGGTCCCCCAGCTGG No data
1202649227_1202649233 24 Left 1202649227 1_KI270706v1_random:165755-165777 CCTAATCATGTCTGCACCTAAGA No data
Right 1202649233 1_KI270706v1_random:165802-165824 CTTATGAACGGTCCCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202649233 Original CRISPR CTTATGAACGGTCCCCCAGC TGG Intergenic
No off target data available for this crispr