ID: 1202649372

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270706v1_random:166431-166453
Sequence AGGGAGAAGCTGGGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202649372_1202649381 5 Left 1202649372 1_KI270706v1_random:166431-166453 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1202649381 1_KI270706v1_random:166459-166481 CTCCCAGAAACTCAGACCCAAGG No data
1202649372_1202649384 7 Left 1202649372 1_KI270706v1_random:166431-166453 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1202649384 1_KI270706v1_random:166461-166483 CCCAGAAACTCAGACCCAAGGGG No data
1202649372_1202649389 23 Left 1202649372 1_KI270706v1_random:166431-166453 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1202649389 1_KI270706v1_random:166477-166499 CAAGGGGCAGCTTCTCACCAGGG No data
1202649372_1202649390 29 Left 1202649372 1_KI270706v1_random:166431-166453 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1202649390 1_KI270706v1_random:166483-166505 GCAGCTTCTCACCAGGGATGTGG No data
1202649372_1202649388 22 Left 1202649372 1_KI270706v1_random:166431-166453 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1202649388 1_KI270706v1_random:166476-166498 CCAAGGGGCAGCTTCTCACCAGG No data
1202649372_1202649382 6 Left 1202649372 1_KI270706v1_random:166431-166453 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1202649382 1_KI270706v1_random:166460-166482 TCCCAGAAACTCAGACCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202649372 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr