ID: 1202662427

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270708v1_random:84125-84147
Sequence GGTCTGACTGTCCCTCACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202662427_1202662430 9 Left 1202662427 1_KI270708v1_random:84125-84147 CCTATGTGAGGGACAGTCAGACC No data
Right 1202662430 1_KI270708v1_random:84157-84179 GTGTTATGGAATCCTATTTGAGG No data
1202662427_1202662432 11 Left 1202662427 1_KI270708v1_random:84125-84147 CCTATGTGAGGGACAGTCAGACC No data
Right 1202662432 1_KI270708v1_random:84159-84181 GTTATGGAATCCTATTTGAGGGG No data
1202662427_1202662431 10 Left 1202662427 1_KI270708v1_random:84125-84147 CCTATGTGAGGGACAGTCAGACC No data
Right 1202662431 1_KI270708v1_random:84158-84180 TGTTATGGAATCCTATTTGAGGG No data
1202662427_1202662428 -5 Left 1202662427 1_KI270708v1_random:84125-84147 CCTATGTGAGGGACAGTCAGACC No data
Right 1202662428 1_KI270708v1_random:84143-84165 AGACCACAGCAGCAGTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202662427 Original CRISPR GGTCTGACTGTCCCTCACAT AGG (reversed) Intergenic
No off target data available for this crispr