ID: 1202664657

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270708v1_random:107169-107191
Sequence TTTGTCCATTCCAACATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202664657_1202664658 -9 Left 1202664657 1_KI270708v1_random:107169-107191 CCTCTCATGTTGGAATGGACAAA No data
Right 1202664658 1_KI270708v1_random:107183-107205 ATGGACAAAGAAGCTTCCTTTGG No data
1202664657_1202664662 27 Left 1202664657 1_KI270708v1_random:107169-107191 CCTCTCATGTTGGAATGGACAAA No data
Right 1202664662 1_KI270708v1_random:107219-107241 TGCACTAATCCCAATCAGGATGG No data
1202664657_1202664661 23 Left 1202664657 1_KI270708v1_random:107169-107191 CCTCTCATGTTGGAATGGACAAA No data
Right 1202664661 1_KI270708v1_random:107215-107237 TAAGTGCACTAATCCCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202664657 Original CRISPR TTTGTCCATTCCAACATGAG AGG (reversed) Intergenic
No off target data available for this crispr