ID: 1202664659

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270708v1_random:107199-107221
Sequence GCACTTATGAAAGAGGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202664659_1202664661 -7 Left 1202664659 1_KI270708v1_random:107199-107221 CCTTTGGCCTCTTTCATAAGTGC No data
Right 1202664661 1_KI270708v1_random:107215-107237 TAAGTGCACTAATCCCAATCAGG No data
1202664659_1202664662 -3 Left 1202664659 1_KI270708v1_random:107199-107221 CCTTTGGCCTCTTTCATAAGTGC No data
Right 1202664662 1_KI270708v1_random:107219-107241 TGCACTAATCCCAATCAGGATGG No data
1202664659_1202664665 19 Left 1202664659 1_KI270708v1_random:107199-107221 CCTTTGGCCTCTTTCATAAGTGC No data
Right 1202664665 1_KI270708v1_random:107241-107263 GCTTTGCCATTACATTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202664659 Original CRISPR GCACTTATGAAAGAGGCCAA AGG (reversed) Intergenic
No off target data available for this crispr