ID: 1202664662

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270708v1_random:107219-107241
Sequence TGCACTAATCCCAATCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202664660_1202664662 -10 Left 1202664660 1_KI270708v1_random:107206-107228 CCTCTTTCATAAGTGCACTAATC No data
Right 1202664662 1_KI270708v1_random:107219-107241 TGCACTAATCCCAATCAGGATGG No data
1202664659_1202664662 -3 Left 1202664659 1_KI270708v1_random:107199-107221 CCTTTGGCCTCTTTCATAAGTGC No data
Right 1202664662 1_KI270708v1_random:107219-107241 TGCACTAATCCCAATCAGGATGG No data
1202664657_1202664662 27 Left 1202664657 1_KI270708v1_random:107169-107191 CCTCTCATGTTGGAATGGACAAA No data
Right 1202664662 1_KI270708v1_random:107219-107241 TGCACTAATCCCAATCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202664662 Original CRISPR TGCACTAATCCCAATCAGGA TGG Intergenic
No off target data available for this crispr