ID: 1202678065

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270711v1_random:25554-25576
Sequence CAGGACACCAAACCTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202678065_1202678068 15 Left 1202678065 1_KI270711v1_random:25554-25576 CCAGGAACAGGTTTGGTGTCCTG No data
Right 1202678068 1_KI270711v1_random:25592-25614 CAAACCTCATTCTTTCTCTTAGG No data
1202678065_1202678070 20 Left 1202678065 1_KI270711v1_random:25554-25576 CCAGGAACAGGTTTGGTGTCCTG No data
Right 1202678070 1_KI270711v1_random:25597-25619 CTCATTCTTTCTCTTAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202678065 Original CRISPR CAGGACACCAAACCTGTTCC TGG (reversed) Intergenic
No off target data available for this crispr