ID: 1202683591

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270712v1_random:30382-30404
Sequence GGCGCGCAAAACGCCGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202683591_1202683596 5 Left 1202683591 1_KI270712v1_random:30382-30404 CCCGCCGCGGCGTTTTGCGCGCC No data
Right 1202683596 1_KI270712v1_random:30410-30432 TTTTTGTCCCCCCGCCGCCGCGG No data
1202683591_1202683604 22 Left 1202683591 1_KI270712v1_random:30382-30404 CCCGCCGCGGCGTTTTGCGCGCC No data
Right 1202683604 1_KI270712v1_random:30427-30449 CCGCGGCTTTTTCCCCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202683591 Original CRISPR GGCGCGCAAAACGCCGCGGC GGG (reversed) Intergenic
No off target data available for this crispr