ID: 1202684662

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270712v1_random:38141-38163
Sequence ATTTGGGCCTAGATTGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202684659_1202684662 -2 Left 1202684659 1_KI270712v1_random:38120-38142 CCTACTTTGAAACAATTGACTAT No data
Right 1202684662 1_KI270712v1_random:38141-38163 ATTTGGGCCTAGATTGATACAGG No data
1202684658_1202684662 8 Left 1202684658 1_KI270712v1_random:38110-38132 CCTTTGTCATCCTACTTTGAAAC No data
Right 1202684662 1_KI270712v1_random:38141-38163 ATTTGGGCCTAGATTGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202684662 Original CRISPR ATTTGGGCCTAGATTGATAC AGG Intergenic
No off target data available for this crispr