ID: 1202691345

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270712v1_random:97120-97142
Sequence GATTTGCCCTGCCCCAACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202691345_1202691351 18 Left 1202691345 1_KI270712v1_random:97120-97142 CCAACGTTGGGGCAGGGCAAATC No data
Right 1202691351 1_KI270712v1_random:97161-97183 GTCCATCTCTGGCCCTGCCTTGG No data
1202691345_1202691353 24 Left 1202691345 1_KI270712v1_random:97120-97142 CCAACGTTGGGGCAGGGCAAATC No data
Right 1202691353 1_KI270712v1_random:97167-97189 CTCTGGCCCTGCCTTGGCCCTGG No data
1202691345_1202691348 7 Left 1202691345 1_KI270712v1_random:97120-97142 CCAACGTTGGGGCAGGGCAAATC No data
Right 1202691348 1_KI270712v1_random:97150-97172 GACACCTCCAAGTCCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202691345 Original CRISPR GATTTGCCCTGCCCCAACGT TGG (reversed) Intergenic
No off target data available for this crispr