ID: 1202693878

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270712v1_random:110768-110790
Sequence GCTCCTGGCAAGGCACAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202693878_1202693886 29 Left 1202693878 1_KI270712v1_random:110768-110790 CCTGGTTGTGCCTTGCCAGGAGC No data
Right 1202693886 1_KI270712v1_random:110820-110842 GCACAGCGGTGGTAGTTGTGTGG No data
1202693878_1202693884 15 Left 1202693878 1_KI270712v1_random:110768-110790 CCTGGTTGTGCCTTGCCAGGAGC No data
Right 1202693884 1_KI270712v1_random:110806-110828 TGAGAGTGTCATGAGCACAGCGG No data
1202693878_1202693885 18 Left 1202693878 1_KI270712v1_random:110768-110790 CCTGGTTGTGCCTTGCCAGGAGC No data
Right 1202693885 1_KI270712v1_random:110809-110831 GAGTGTCATGAGCACAGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202693878 Original CRISPR GCTCCTGGCAAGGCACAACC AGG (reversed) Intergenic
No off target data available for this crispr