ID: 1202696742

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270712v1_random:131790-131812
Sequence GTTCCCCAACGGAGACCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202696732_1202696742 11 Left 1202696732 1_KI270712v1_random:131756-131778 CCACGGACCCAGGCAGGATCACC No data
Right 1202696742 1_KI270712v1_random:131790-131812 GTTCCCCAACGGAGACCCTCGGG No data
1202696735_1202696742 3 Left 1202696735 1_KI270712v1_random:131764-131786 CCAGGCAGGATCACCTGGACCTC No data
Right 1202696742 1_KI270712v1_random:131790-131812 GTTCCCCAACGGAGACCCTCGGG No data
1202696738_1202696742 -10 Left 1202696738 1_KI270712v1_random:131777-131799 CCTGGACCTCTGGGTTCCCCAAC No data
Right 1202696742 1_KI270712v1_random:131790-131812 GTTCCCCAACGGAGACCCTCGGG No data
1202696734_1202696742 4 Left 1202696734 1_KI270712v1_random:131763-131785 CCCAGGCAGGATCACCTGGACCT No data
Right 1202696742 1_KI270712v1_random:131790-131812 GTTCCCCAACGGAGACCCTCGGG No data
1202696729_1202696742 26 Left 1202696729 1_KI270712v1_random:131741-131763 CCATCGGACGCTCGGCCACGGAC No data
Right 1202696742 1_KI270712v1_random:131790-131812 GTTCCCCAACGGAGACCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202696742 Original CRISPR GTTCCCCAACGGAGACCCTC GGG Intergenic
No off target data available for this crispr