ID: 1202701112

View in Genome Browser
Species Human (GRCh38)
Location 1_KI270712v1_random:165383-165405
Sequence CAGCCCGAAGACTTTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202701112_1202701117 7 Left 1202701112 1_KI270712v1_random:165383-165405 CCCACCACAAAGTCTTCGGGCTG No data
Right 1202701117 1_KI270712v1_random:165413-165435 ATGGTGCTGAGGTAATCTAGAGG No data
1202701112_1202701116 -4 Left 1202701112 1_KI270712v1_random:165383-165405 CCCACCACAAAGTCTTCGGGCTG No data
Right 1202701116 1_KI270712v1_random:165402-165424 GCTGATTGTCAATGGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202701112 Original CRISPR CAGCCCGAAGACTTTGTGGT GGG (reversed) Intergenic
No off target data available for this crispr